circad | circRNAs associated with diseases

hsa_circ_0000488
Gene	DLEU2	Organism	Human
Genome Locus	chr13:50680743-50681192:-	Build	hg19
Disease	Acute Myeloid Leukemia	ICD-10	Acute megakaryoblastic leukaemia (C94.2)
DBLink	Link to database	PMID	30037980
Experimental Method
Sample Type	Bone Marrow samples and cell lines	Comparison	20 cytogenetically normal AML (CN103 AML) patients and 20 healthy controls
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGACTGCGTAAAGGCAAACAC Reverse AGGGTAGCCCCTAAAACAAGT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wu, DM, Wen, X, Han, XR, Wang, S, Wang, YJ, Shen, M, Fan, SH, Zhang, ZF, Shan, Q, Li, MQ, Hu, B, Chen, GQ, Lu, J, Zheng, YL (2018). Role of Circular RNA DLEU2 in Human Acute Myeloid Leukemia. Mol. Cell. Biol., 38, 20:no page given.